Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T7758
Clone ID E7758
Template ID T7758
Template Origin Plasmid
Clone Image 6312358
Validity OK
Gene symbol Nhlh1
Gene description nescient helix loop helix 1
Gene Aliases Hen1, Nscl, Tal2
MGI ID MGI:98481
Entrez Gene ID 18071
Ref Seq Accession NM_010916
Chromosome Location 1
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6.1
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 84
Template Well C11
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC051018
TGU M
 Template Sequence