Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T7846
Clone ID E7846
Template ID T7846
Template Origin Plasmid
Clone Image 6390018
Validity OK
Gene symbol Gfra1
Gene description glial cell line derived neurotrophic factor family receptor alpha 1
Gene Aliases AU042498
MGI ID MGI:1100842
Entrez Gene ID 14585
Ref Seq Accession NM_010279
Chromosome Location 19
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6.1
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 85
Template Well C06
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC054378
TGU M
 Template Sequence