Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T8101
Clone ID E8101
Template ID T8101
Template Origin Plasmid
Clone Image 30093248
Validity OK
Gene symbol Itga4
Gene description integrin alpha 4
Gene Aliases CD49D
MGI ID MGI:96603
Entrez Gene ID 16401
Ref Seq Accession NM_010576
Chromosome Location 2
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pSPORT1
AntiSense Promoter Sp6
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 88
Template Well C07
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC068313
TGU M
 Template Sequence