Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T8373
Clone ID E8373
Template ID T8373
Template Origin Plasmid
Clone Image 3468639
Validity OK
Gene symbol Arhgap15
Gene description Rho GTPase activating protein 15
Gene Aliases 5830480G12Rik
MGI ID MGI:1923367
Entrez Gene ID 76117
Ref Seq Accession NM_153820
Chromosome Location 2
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 91
Template Well B10
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC034881
TGU M
 Template Sequence