Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T8464
Clone ID E8464
Template ID T8464
Template Origin Plasmid
Clone Image 5702449
Validity OK
Gene symbol Tcf7l2
Gene description transcription factor 7-like 2, T-cell specific, HMG-box
Gene Aliases TCF4B, TCF4E, Tcf-4, Tcf4, mTcf-4B, mTcf-4E
MGI ID MGI:1202879
Entrez Gene ID 21416
Ref Seq Accession NM_009333
Chromosome Location 19
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pYX-Asc
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD T3
Forward Primer Sequences ATTAACCCTCACTAAAGGGA
Reverse Primer RZPD T7
Reverse Primer Sequences TAATACGACTCACTATAGGG
Template Plate  
Template Well  
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC052022
TGU  
 Template Sequence