Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T8679
Clone ID E8679
Template ID T8679
Template Origin Plasmid
Clone Image 6401526
Validity OK
Gene symbol Gja5
Gene description Mus musculus gap junction membrane channel protein alpha 5 (Gja5), mRNA.
Gene Aliases Cx40, Cnx40, Gja-5, 5730555N10Rik
MGI ID MGI:95716
Entrez Gene ID 14613
Ref Seq Accession NM_008121
Chromosome Location 3
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pYX-Asc
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD T3
Forward Primer Sequences ATTAACCCTCACTAAAGGGA
Reverse Primer RZPD T7
Reverse Primer Sequences TAATACGACTCACTATAGGG
Template Plate 95
Template Well E10
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC053054
TGU B
 Template Sequence