Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T8870
Clone ID E8870
Template ID T8870
Template Origin Plasmid
Clone Image 6414270
Validity OK
Gene symbol Lhx5
Gene description Mus musculus LIM homeobox protein 5 (Lhx5), mRNA.
Gene Aliases Lim2
MGI ID MGI:107792
Entrez Gene ID 16873
Ref Seq Accession NM_008499
Chromosome Location 5
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pYX-Asc
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD T3
Forward Primer Sequences ATTAACCCTCACTAAAGGGA
Reverse Primer RZPD T7
Reverse Primer Sequences TAATACGACTCACTATAGGG
Template Plate 97
Template Well F03
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC057585
TGU B
 Template Sequence