Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T8893
Clone ID E8893
Template ID T8893
Template Origin Plasmid
Clone Image 6415629
Validity OK
Gene symbol Vim
Gene description Mus musculus vimentin (Vim), mRNA.
Gene Aliases MGC102095
MGI ID MGI:98932
Entrez Gene ID 22352
Ref Seq Accession NM_011701
Chromosome Location 2
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pYX-Asc
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD T3
Forward Primer Sequences ATTAACCCTCACTAAAGGGA
Reverse Primer RZPD T7
Reverse Primer Sequences TAATACGACTCACTATAGGG
Template Plate 97
Template Well H02
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC089335
TGU B
 Template Sequence