Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T8896
Clone ID E8896
Template ID T8896
Template Origin Plasmid
Clone Image 6415801
Validity OK
Gene symbol Wnt7a
Gene description Mus musculus wingless-related MMTV integration site 7A (Wnt7a), mRNA.
Gene Aliases px, tw, Wnt-7a
MGI ID MGI:98961
Entrez Gene ID 22421
Ref Seq Accession NM_009527
Chromosome Location 6
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pYX-Asc
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD T3
Forward Primer Sequences ATTAACCCTCACTAAAGGGA
Reverse Primer RZPD T7
Reverse Primer Sequences TAATACGACTCACTATAGGG
Template Plate 97
Template Well H05
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC049093BC057586
TGU B
 Template Sequence