Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T890
Clone ID E890
Template ID T890
Template Origin Plasmid
Clone Image 1924118
Validity OK
Gene symbol Tst
Gene description thiosulfate sulfurtransferase, mitochondrial (Tst)
Gene Aliases Rhodanese
MGI ID MGI:98852
Entrez Gene ID 22117
Ref Seq Accession NM_009437
Chromosome Location 15
ENSEMBL Transcript ID ENSMUST00000058659
ENSEMBL Gene ID ENSMUSG00000044986
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 10
Template Well E01
Template Group  
Template Sequence Status Partial
Template Sequence ID 1924118_r1AI785977BX
TGU B
 Template Sequence