Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T9098
Clone ID E9098
Template ID T9098
Template Origin Plasmid
Clone Image 6821724
Validity OK
Gene symbol Ephb1
Gene description Mus musculus Eph receptor B1 (Ephb1), mRNA.
Gene Aliases Elk, Net, Cek6, Elkh, Hek6, 9330129L11
MGI ID MGI:1096337
Entrez Gene ID 270190
Ref Seq Accession NM_173447
Chromosome Location 9
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pYX-Asc
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD T3
Forward Primer Sequences ATTAACCCTCACTAAAGGGA
Reverse Primer RZPD T7
Reverse Primer Sequences TAATACGACTCACTATAGGG
Template Plate  
Template Well  
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC057301
TGU  
 Template Sequence