Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T9109
Clone ID E9109
Template ID T9109
Template Origin Plasmid
Clone Image 6822095
Validity OK
Gene symbol Usp25
Gene description Mus musculus ubiquitin specific protease 25 (Usp25), mRNA.
Gene Aliases  
MGI ID MGI:1353655
Entrez Gene ID 30940
Ref Seq Accession NM_013918
Chromosome Location 16
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pYX-Asc
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD T3
Forward Primer Sequences ATTAACCCTCACTAAAGGGA
Reverse Primer RZPD T7
Reverse Primer Sequences TAATACGACTCACTATAGGG
Template Plate 103
Template Well H11
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC048171BC063059
TGU B
 Template Sequence