Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T9351
Clone ID E9351
Template ID T9351
Template Origin Plasmid
Clone Image 6851153
Validity OK
Gene symbol Foxp2
Gene description Mus musculus forkhead box P2 (Foxp2), transcript variant 2, mRNA.
Gene Aliases CAG-16, D0Kist7, 2810043D05Rik
MGI ID MGI:2148705
Entrez Gene ID 114142
Ref Seq Accession NM_212435
Chromosome Location 6
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pYX-Asc
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD T3
Forward Primer Sequences ATTAACCCTCACTAAAGGGA
Reverse Primer RZPD T7
Reverse Primer Sequences TAATACGACTCACTATAGGG
Template Plate 106
Template Well E07
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC062926
TGU B
 Template Sequence