Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T9406
Clone ID E9406
Template ID T9406
Template Origin Plasmid
Clone Image 30355523
Validity OK
Gene symbol St3gal1
Gene description Mus musculus ST3 beta-galactoside alpha-2,3-sialyltransferase 1 (St3gal1), mRNA.
Gene Aliases MGC, Siat4, Siat4a, ST3GalI, St3gal-1
MGI ID MGI:98304
Entrez Gene ID 20442
Ref Seq Accession NM_009177
Chromosome Location 15
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pYX-Asc
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD T3
Forward Primer Sequences ATTAACCCTCACTAAAGGGA
Reverse Primer RZPD T7
Reverse Primer Sequences TAATACGACTCACTATAGGG
Template Plate 107
Template Well B02
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC084730
TGU M
 Template Sequence