Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T9640
Clone ID E9640
Template ID T9640
Template Origin Plasmid
Clone Image 6585574
Validity OK
Gene symbol Rgs13
Gene description Mus musculus regulator of G-protein signaling 13 (Rgs13), mRNA.
Gene Aliases  
MGI ID MGI:2180585
Entrez Gene ID 246709
Ref Seq Accession NM_153171
Chromosome Location 1
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pDNR-LIB
AntiSense Promoter T3
Sense Promoter T7
Forward Primer M13 forward (-21)
Forward Primer Sequences TGTAAAACGACGGCCAGT
Reverse Primer T3-pDNR-LIB rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGTGTTCACTTACCTACTGGGC
Template Plate 1002
Template Well B12
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC049624
TGU M
 Template Sequence