Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T9962
Clone ID E9962
Template ID T9962
Template Origin Plasmid
Clone Image 30253829
Validity OK
Gene symbol Pomc1
Gene description Mus musculus pro-opiomelanocortin-alpha (Pomc1), mRNA.
Gene Aliases ACTH, POMC, Pomc-1, beta-MSH, alpha-MSH,
MGI ID MGI:97742
Entrez Gene ID 18976
Ref Seq Accession NM_008895
Chromosome Location 12
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pDNR-LIB
AntiSense Promoter T3
Sense Promoter T7
Forward Primer M13 forward (-21)
Forward Primer Sequences TGTAAAACGACGGCCAGT
Reverse Primer T3-pDNR-LIB rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGTGTTCACTTACCTACTGGGC
Template Plate 1005
Template Well F01
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC061215
TGU M
 Template Sequence