Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T9963
Clone ID E9963
Template ID T9963
Template Origin Plasmid
Clone Image 30250975
Validity OK
Gene symbol Gh
Gene description Mus musculus growth hormone (Gh), mRNA.
Gene Aliases  
MGI ID MGI:95707
Entrez Gene ID 14599
Ref Seq Accession NM_008117
Chromosome Location 11
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pDNR-LIB
AntiSense Promoter T3
Sense Promoter T7
Forward Primer M13 forward (-21)
Forward Primer Sequences TGTAAAACGACGGCCAGT
Reverse Primer T3-pDNR-LIB rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGTGTTCACTTACCTACTGGGC
Template Plate 1005
Template Well F02
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC061157
TGU M
 Template Sequence