Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T9977
Clone ID E9977
Template ID T9977
Template Origin Plasmid
Clone Image 30301284
Validity OK
Gene symbol Myl2
Gene description Mus musculus myosin, light polypeptide 2, regulatory, cardiac, slow (Myl2), mRNA.
Gene Aliases MLC-2, Mlc2v, Mylpc, MLC-2v
MGI ID MGI:97272
Entrez Gene ID 17906
Ref Seq Accession NM_010861
Chromosome Location 5
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pDNR-LIB
AntiSense Promoter T3
Sense Promoter T7
Forward Primer M13 forward (-21)
Forward Primer Sequences TGTAAAACGACGGCCAGT
Reverse Primer T3-pDNR-LIB rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGTGTTCACTTACCTACTGGGC
Template Plate 1005
Template Well G04
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC061144
TGU M
 Template Sequence