Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T3973
Clone ID E3973
Template ID T3973
Template Origin Plasmid
Clone Image 2331825
Validity OK
Gene symbol Hoxa7
Gene description homeo box A7
Gene Aliases AV118143, Hox-1.1
MGI ID MGI:96179
Entrez Gene ID 15404
Ref Seq Accession NM_010455
Chromosome Location 6
ENSEMBL Transcript ID  
ENSEMBL Gene ID ENSMUSG00000038236
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 44
Template Well C08
Template Group ENCODE
Template Sequence Status Partial
Template Sequence ID BC061149
TGU B
 Template Sequence